Ultimate Precision Probes mit einem internen Quencher                                            
progress bar
progress bar

eurofins eurofins

Email
Password
 
  
Forgot Password?
Create Account
 
 
  • Quick Order
  • 0

    Cart

  • Account
    • Login
    • Create Account
  • Produkte & Services
    • Oligonukleotid-Synthese
      • Produkte & Services
      • Oligonukleotid-Synthese
        • qPCR application oligos
        • PCR Primers
        • qPCR Probes
        • Ultimate Precision Probes
        • Next Generation Sequencing Oligos
        • NGSgrade Oligos
        • NGSgrade Oligos 2.0
        • NGS UDI Primer Sets
        • Sanger Sequencing Oligos
        • SeqPrimer
        • Standard Primers
        • Cloning applications & CRISPR
        • Cloning Oligo
        • EXTREmers
        • Custom DNA & RNA Oligos
        • Custom DNA Oligos
        • Salt Free Oligos
        • Custom RNA Oligos
        • siMAX siRNA
        • Large Scale Oligos
        • Spezialanfragen
        • Oligo Design Tools
        • Oligo Analysis Tool
        • PCR Primer Design Tool
        • qPCR Assay Design Tool
        • Sequencing Primer Design Tool
        • Hilfreiche Links
        • Oligo Decision Tree
        • Excel Upload Formulare Oligos

        • Prepaid Oligo Coupons
          Eine einzigartige Vorauszahlungsoption für PCR- und Sequenzier-Primer
          Mehr Erfahren

           

           

    • Gensynthese & Molekularbiologie
      • Produkte & Services
      • Gensynthese & Molekularbiologie
        • Synthetische Gene
        • Standard Gene
        • Express Gene
        • Complex Genes
        • Gene Fragments
        • GeneStrands
        • Express GeneStrands
        • Optimierungs-Tool
        • GENEius
        • Molekular Biologische Services
        • Plasmid Präparation
        • Ortsgerichtete Mutagenese (SDM)
        • DNA Klonierung
        • IVT mRNA
        • Spezielle Anfragen
        • Individuelle Projekte
        • Hilfreiche Links
        • FAQs Gensynthese / Molekularbiologie
        • Gensynthese Angebot
        • Plasmid Präparation
          Hochwertige DNA für zuverlässige Ergebnisse. Von 15µg bis zu 20mg.

          Jetzt bestellen

           

           

    • Sanger Sequenzierung
      • Produkte & Services
      • Sanger Sequenzierung
        • Standard Sanger Services
        • TubeSeq Supreme
        • PlateSeq Supreme
        • Services Für Premixed Proben
        • Mix2Seq
        • LightRun Services
        • Spezielle Sequenzier-Services
        • Direct Colony Sequencing
        • Sequenzverifizierung und Primer Walking (ISO 17025/GLP)
        • Versandoptionen
        • Kostenlose Probenabholung
        • Probenversand
        • Service kostenlos testen
        • Kostenlosen Test Erhalten
        • Hilfreiche Links
        • FAQs Sanger Sequenzierung
        • Sequenzier-Primer
        • Sequencing Result Guide
        • Mix2Seq Kit
          Schnellste Sanger-Sequenzierung von Premixed Proben in Tubes.

          Jetzt bestellen

           

           

    • Nanopore Sequenzierung
      • Produkte & Services
      • Nanopore Sequenzierung
        • ONT Lite Portfolio - Produkte
        • Whole Plasmid Sequencing
        • Klonale Amplikonsequenzierung
        • Genomsequenzierung von Bakterien
        • Genomsequenzierung von Hefen
        • Hybrid-Assemblierung von Bakterien
        • ONT Lite - Zusätzliche Services
        • Prepaid ONT Coupons
        • Kostenlose Barodes
        • ONT Lite Assembly Review
        • Genom-Sequenzierung (Projekte - ganze Flow Cells)
        • Human-Genomsequenzierung
        • Bakterien-Genomsequenzierung
        • Whole Genome Sequencing Non-Human
        • Amplikon-Sequenzierung (Projekte - ganze Flow Cells)
        • Custom Long-Read Amplicon Sequencing
        • 16S Volllängen-Mikrobiom
        • Prepaid ONT Lite Coupons
          Eine einzigartige "Pre-Payment"-Methode für Ihre Oxford Nanopore Sequenzierung

          Mehr erfahren

           

           

    • Next Generation Sequencing
      • Produkte & Services
      • Next Generation Sequencing
        • Genom-Sequenzierung
        • Short-read WGS
        • Long-read WGS
        • INVIEW Resequencing
        • Mikrobiom & Metagenom
        • INVIEW Microbiome
        • INVIEW Metagenome
        • Amplikon-Sequenzierung
        • Amplikon-Sequenzierung
        • Amplikon-Sequenzierung – Komplettservice
        • Transkriptom-Sequenzierung
        • INVIEW Transcriptome
        • INVIEW Transcriptome Bacteria
        • NGSelect RNA
        • Exome & Enrichment
        • INVIEW Exome
        • Clinical Research Exome
        • INVIEW Oncoprofiling
        • INVIEW Liquid Biopsy Oncoprofiling
        • Bioinformatische Services
        • RNA-Seq Analysis
        • Variant Analysis Service
        • Metagenome Analysis Service
        • Microbiome Profiling Analysis
        • Prepaid Coupons and free Barcodes
        • Free Barcodes
        • NGS Prepaid Coupons
        • Wichtige Informationen
        • Probenvorbereitung - Versand
        • Publikationen
        • Spezielle Anwendungen
        • INVIEW Virus
        • Ready-to-Load
        • Prepaid NGS Coupons
          Eine einzigartige Vorauszahlungsoption für unsere NGS Services
          Mehr erfahren

           

           

    • Genotypisierung & Genexpression
      • Produkte & Services
      • Genotypisierung & Genexpression
        • Applied Genomic Services
        • DNA Barcoding
        • Zelllinienauthentifizierung
        • Mycoplasmacheck
        • Fragmentlängen-Analyse
        • Genotyping Services
        • SNP Genotypisierung
        • Copy Number Variation
        • Mikrosatellites/ STR/ FLA/ IDAA
        • Genexpression Services
        • Transkriptomanalyse
        • Expressionsarrays
        • Target Gene Expression
        • Spezies-Bestimmung
        • Fleisch-Bestimmung
        • Pflanzen-Bestimmung
        • Fisch-Bestimmung
        • Metabarcoding mittels NGS
        • Bestellseiten für die Spezies-Bestimmung
          Fleisch‑, Pflanzen‑ und Fischspezies präzise identifizieren und die Authentizität verifizieren.

          Fleisch-Testung

          Pflanzen-Testung

          Fisch-Testung

  • Märkte
    • Alle Märkte
    • Pharma / Biotech
      • Märkte
      • Pharma / Biotech
        • Syntheseprodukte
        • Industrie-optimierte NGS Oligos
        • Ultimate Precision Probes
        • Spezielle Oligo Anfragen
        • Large-Scale Oligos
        • Gensynthese
        • GeneStrands
        • Sequenzier-Services
        • Exome Sequencing
        • Transcriptome Sequencing
        • Genome Sequencing
        • Bioinformatic Solutions for NGS
        • Interessante Artikel (En)
        • NGS - Disease Diagnostics
        • Cancer Ecology
        • Personalised Cancer Therapy
        • Revolutionising human-like-protein production
        • The Microbiome Of Cancer
        • All about biomarker discovery
    • Agrigenomics
      • Märkte
      • Agrigenomics
        • Pflanzenzüchter
        • DNA marker discovery
        • Marker-assisted selection
        • GRAS-Di®
        • Microbiome and metagenomics
        • Tierzüchter
        • DNA Marker discovery
        • Pathogen screening
        • Parentage testing
        • Genomic selection
        • Marker-assisted selection
        • Interessante Artikel (En)
        • Microarrays Accelerate Blue Biotechnology
        • How To Do NGS 50% Faster
        • NGS Portfolio
    • Consumer Genomics
      • Märkte
      • Consumer Genomics
        • Sequenzierung Services
        • Genotyping
        • Epigenome Profiling
        • Microbiome Analysis
        • Shotgun Sequencing
        • Whole Genome Sequencing
        • Ergänzende Services
        • Sample Collection Kits
        • Shipping
        • DNA Extraction
        • Laboratory Service
        • Biobanking
        • Interessante Artikel (En)
        • Population Genetics
        • The End of Gene Doping
        • Home Genomics Testing
        • IVDR Compliance
    • Nahrungsmittel und Umwelt
      • Märkte
      • Nahrungsmittel und Umwelt
        • Lebensmittel-Tests
        • Food Authenticity
        • Meat Traceability
        • Pathogen Traceability
        • Cannabis and Hemp Testing
        • Umwelt-Tests
        • Non-targeted detection of organisms / species
        • Targeted detection of organisms / species
        • eDNA Tracker
        • Interessante Artikel (En)
        • Determine the Source of Meat
        • Pine Nuts – Why Testing For Edibility Matters
        • Bestellseiten für die Spezies-Bestimmung
          Fleisch‑, Pflanzen‑ und Fischspezies präzise identifizieren und die Authentizität verifizieren.

          Fleisch-Testung

          Pflanzen-Testung

          Fisch-Testung

    • Diagnostik Kit Produzenten
      • Märkte
      • Diagnostik Kit Produzenten
        • Syntheseprodukte
        • Large-Scale Oligos
        • Spezialanfragen für Oligos
        • Gensynthese Projekte
        • Qualitätssicherung
        • GLP
        • ISO 17025
        • ISO 13485
        • Interessante Artikel (En)
        • Oligonucleotides For Diagnostics
        • The Future of RNA Applications
    • Forschung / Biotech
      • Märkte
      • Forschung / Biotech
        • Beliebte Services
        • Custom DNA Oligos
        • TubeSeq Service Sanger
        • INVIEW Microbiome NGS
        • NGS Services
        • GeneStrands
        • Express Services
        • Mix2Seq NightXpress
        • Express Genes
        • Express GeneStrands
        • Interessante Artikel (En)
        • Eurofins Genomics Goes Green
        • GENEius – Codon Usage Optimisation
        • 5 tips to speed up your qPCR
        • Why salt-free oligos are the unsung hero of molecular biology
  • Infos & Tools
    • Account
      • Infos & Tools
      • Account
        • Mein Profil
        • Bestellungen
        • Angebote
        • Gruppen
        • Einstellungen
        • Adressen
        • Dropboxen in der Nähe
        • Barcode Management
        • Sanger Kits & Barcodes
        • NGS Barcodes & Coupons
        • Genotyping Barcodes
        • Oligo Coupons
        • Primer / Cell Line Management
        • Sanger Proben & Primer
        • Zelllinien Management
    • Bezahloptionen
      • Infos & Tools
      • Bezahloptionen
        • EVOCARD Optionen
        • EVOcard Bezahlung
        • Neubestellung oder Aufladung EVOcard
    • Hilfe
      • Infos & Tools
      • Hilfe
        • Produkt FAQs
        • Video Anleitungen
        • GENEius
        • Excel Upload Formulare Oligos
        • Oligo Decision Tree
        • GATCViewer
    • Tools
      • Infos & Tools
      • Tools
        • Design Tools
        • Oligo Analyse Tool
        • PCR Primer Design Tool
        • Sequencing Primer Design Tool
    • Hilfe Center
      • Infos & Tools
      • Hilfe Center
        • NGS Probenversand
        • Wie sende ich meine NGS‑Proben ein?
        • Wie finde ich die nächstgelegene Dropbox‑Station?
        • Wie bestelle ich NGS‑Barcodes?
        • Wie sende ich Ersatzproben für NGS ein?
        • Wie bestelle ich ein UPS‑Label für den Versand meiner NGS‑Proben?
        • NGS Angebote
        • Wie fordere ich ein NGS‑Angebot an?
        • Wie akzeptiere ich ein NGS‑Angebot?
        • Bestellungen & Daten
        • Wie verwalte ich meine Bestellungen?
        • Wie verfolge ich den Status meiner NGS‑Probe
        • Wie greife ich auf meine NGS‑Daten zu
  • Über uns
    • Über uns
      • Über uns
      • Über uns
        • Über Eurofins
        • Karriere
        • Distributoren
        • Neuigkeiten
        • Schließzeiten der Labore
        • Events
        • Impressum
    • Qualitätssicherung
      • Über uns
      • Qualitätssicherung
        • Qualitätssicherung
    • Angebote und Aktionen
      • Über uns
      • Angebote und Aktionen
        • Alle Angebote und Aktionen
        • Services Kostenlos Testen
        • Gensynthese-Angebot
  • Kontakt
Logo
  • Produkte & Services
    • Oligonukleotid-Synthese
      • Produkte & Services
      • Oligonukleotid-Synthese
        • qPCR application oligos
        • PCR Primers
        • qPCR Probes
        • Ultimate Precision Probes
        • Next Generation Sequencing Oligos
        • NGSgrade Oligos
        • NGSgrade Oligos 2.0
        • NGS UDI Primer Sets
        • Sanger Sequencing Oligos
        • SeqPrimer
        • Standard Primers
        • Cloning applications & CRISPR
        • Cloning Oligo
        • EXTREmers
        • Custom DNA & RNA Oligos
        • Custom DNA Oligos
        • Salt Free Oligos
        • Custom RNA Oligos
        • siMAX siRNA
        • Large Scale Oligos
        • Spezialanfragen
        • Oligo Design Tools
        • Oligo Analysis Tool
        • PCR Primer Design Tool
        • qPCR Assay Design Tool
        • Sequencing Primer Design Tool
        • Hilfreiche Links
        • Oligo Decision Tree
        • Excel Upload Formulare Oligos

        • Prepaid Oligo Coupons
          Eine einzigartige Vorauszahlungsoption für PCR- und Sequenzier-Primer
          Mehr Erfahren

           

           

    • Gensynthese & Molekularbiologie
      • Produkte & Services
      • Gensynthese & Molekularbiologie
        • Synthetische Gene
        • Standard Gene
        • Express Gene
        • Complex Genes
        • Gene Fragments
        • GeneStrands
        • Express GeneStrands
        • Optimierungs-Tool
        • GENEius
        • Molekular Biologische Services
        • Plasmid Präparation
        • Ortsgerichtete Mutagenese (SDM)
        • DNA Klonierung
        • IVT mRNA
        • Spezielle Anfragen
        • Individuelle Projekte
        • Hilfreiche Links
        • FAQs Gensynthese / Molekularbiologie
        • Gensynthese Angebot
        • Plasmid Präparation
          Hochwertige DNA für zuverlässige Ergebnisse. Von 15µg bis zu 20mg.

          Jetzt bestellen

           

           

    • Sanger Sequenzierung
      • Produkte & Services
      • Sanger Sequenzierung
        • Standard Sanger Services
        • TubeSeq Supreme
        • PlateSeq Supreme
        • Services Für Premixed Proben
        • Mix2Seq
        • LightRun Services
        • Spezielle Sequenzier-Services
        • Direct Colony Sequencing
        • Sequenzverifizierung und Primer Walking (ISO 17025/GLP)
        • Versandoptionen
        • Kostenlose Probenabholung
        • Probenversand
        • Service kostenlos testen
        • Kostenlosen Test Erhalten
        • Hilfreiche Links
        • FAQs Sanger Sequenzierung
        • Sequenzier-Primer
        • Sequencing Result Guide
        • Mix2Seq Kit
          Schnellste Sanger-Sequenzierung von Premixed Proben in Tubes.

          Jetzt bestellen

           

           

    • Nanopore Sequenzierung
      • Produkte & Services
      • Nanopore Sequenzierung
        • ONT Lite Portfolio - Produkte
        • Whole Plasmid Sequencing
        • Klonale Amplikonsequenzierung
        • Genomsequenzierung von Bakterien
        • Genomsequenzierung von Hefen
        • Hybrid-Assemblierung von Bakterien
        • ONT Lite - Zusätzliche Services
        • Prepaid ONT Coupons
        • Kostenlose Barodes
        • ONT Lite Assembly Review
        • Genom-Sequenzierung (Projekte - ganze Flow Cells)
        • Human-Genomsequenzierung
        • Bakterien-Genomsequenzierung
        • Whole Genome Sequencing Non-Human
        • Amplikon-Sequenzierung (Projekte - ganze Flow Cells)
        • Custom Long-Read Amplicon Sequencing
        • 16S Volllängen-Mikrobiom
        • Prepaid ONT Lite Coupons
          Eine einzigartige "Pre-Payment"-Methode für Ihre Oxford Nanopore Sequenzierung

          Mehr erfahren

           

           

    • Next Generation Sequencing
      • Produkte & Services
      • Next Generation Sequencing
        • Genom-Sequenzierung
        • Short-read WGS
        • Long-read WGS
        • INVIEW Resequencing
        • Mikrobiom & Metagenom
        • INVIEW Microbiome
        • INVIEW Metagenome
        • Amplikon-Sequenzierung
        • Amplikon-Sequenzierung
        • Amplikon-Sequenzierung – Komplettservice
        • Transkriptom-Sequenzierung
        • INVIEW Transcriptome
        • INVIEW Transcriptome Bacteria
        • NGSelect RNA
        • Exome & Enrichment
        • INVIEW Exome
        • Clinical Research Exome
        • INVIEW Oncoprofiling
        • INVIEW Liquid Biopsy Oncoprofiling
        • Bioinformatische Services
        • RNA-Seq Analysis
        • Variant Analysis Service
        • Metagenome Analysis Service
        • Microbiome Profiling Analysis
        • Prepaid Coupons and free Barcodes
        • Free Barcodes
        • NGS Prepaid Coupons
        • Wichtige Informationen
        • Probenvorbereitung - Versand
        • Publikationen
        • Spezielle Anwendungen
        • INVIEW Virus
        • Ready-to-Load
        • Prepaid NGS Coupons
          Eine einzigartige Vorauszahlungsoption für unsere NGS Services
          Mehr erfahren

           

           

    • Genotypisierung & Genexpression
      • Produkte & Services
      • Genotypisierung & Genexpression
        • Applied Genomic Services
        • DNA Barcoding
        • Zelllinienauthentifizierung
        • Mycoplasmacheck
        • Fragmentlängen-Analyse
        • Genotyping Services
        • SNP Genotypisierung
        • Copy Number Variation
        • Mikrosatellites/ STR/ FLA/ IDAA
        • Genexpression Services
        • Transkriptomanalyse
        • Expressionsarrays
        • Target Gene Expression
        • Spezies-Bestimmung
        • Fleisch-Bestimmung
        • Pflanzen-Bestimmung
        • Fisch-Bestimmung
        • Metabarcoding mittels NGS
        • Bestellseiten für die Spezies-Bestimmung
          Fleisch‑, Pflanzen‑ und Fischspezies präzise identifizieren und die Authentizität verifizieren.

          Fleisch-Testung

          Pflanzen-Testung

          Fisch-Testung

  • Märkte
    • Alle Märkte
    • Pharma / Biotech
      • Märkte
      • Pharma / Biotech
        • Syntheseprodukte
        • Industrie-optimierte NGS Oligos
        • Ultimate Precision Probes
        • Spezielle Oligo Anfragen
        • Large-Scale Oligos
        • Gensynthese
        • GeneStrands
        • Sequenzier-Services
        • Exome Sequencing
        • Transcriptome Sequencing
        • Genome Sequencing
        • Bioinformatic Solutions for NGS
        • Interessante Artikel (En)
        • NGS - Disease Diagnostics
        • Cancer Ecology
        • Personalised Cancer Therapy
        • Revolutionising human-like-protein production
        • The Microbiome Of Cancer
        • All about biomarker discovery
    • Agrigenomics
      • Märkte
      • Agrigenomics
        • Pflanzenzüchter
        • DNA marker discovery
        • Marker-assisted selection
        • GRAS-Di®
        • Microbiome and metagenomics
        • Tierzüchter
        • DNA Marker discovery
        • Pathogen screening
        • Parentage testing
        • Genomic selection
        • Marker-assisted selection
        • Interessante Artikel (En)
        • Microarrays Accelerate Blue Biotechnology
        • How To Do NGS 50% Faster
        • NGS Portfolio
    • Consumer Genomics
      • Märkte
      • Consumer Genomics
        • Sequenzierung Services
        • Genotyping
        • Epigenome Profiling
        • Microbiome Analysis
        • Shotgun Sequencing
        • Whole Genome Sequencing
        • Ergänzende Services
        • Sample Collection Kits
        • Shipping
        • DNA Extraction
        • Laboratory Service
        • Biobanking
        • Interessante Artikel (En)
        • Population Genetics
        • The End of Gene Doping
        • Home Genomics Testing
        • IVDR Compliance
    • Nahrungsmittel und Umwelt
      • Märkte
      • Nahrungsmittel und Umwelt
        • Lebensmittel-Tests
        • Food Authenticity
        • Meat Traceability
        • Pathogen Traceability
        • Cannabis and Hemp Testing
        • Umwelt-Tests
        • Non-targeted detection of organisms / species
        • Targeted detection of organisms / species
        • eDNA Tracker
        • Interessante Artikel (En)
        • Determine the Source of Meat
        • Pine Nuts – Why Testing For Edibility Matters
        • Bestellseiten für die Spezies-Bestimmung
          Fleisch‑, Pflanzen‑ und Fischspezies präzise identifizieren und die Authentizität verifizieren.

          Fleisch-Testung

          Pflanzen-Testung

          Fisch-Testung

    • Diagnostik Kit Produzenten
      • Märkte
      • Diagnostik Kit Produzenten
        • Syntheseprodukte
        • Large-Scale Oligos
        • Spezialanfragen für Oligos
        • Gensynthese Projekte
        • Qualitätssicherung
        • GLP
        • ISO 17025
        • ISO 13485
        • Interessante Artikel (En)
        • Oligonucleotides For Diagnostics
        • The Future of RNA Applications
    • Forschung / Biotech
      • Märkte
      • Forschung / Biotech
        • Beliebte Services
        • Custom DNA Oligos
        • TubeSeq Service Sanger
        • INVIEW Microbiome NGS
        • NGS Services
        • GeneStrands
        • Express Services
        • Mix2Seq NightXpress
        • Express Genes
        • Express GeneStrands
        • Interessante Artikel (En)
        • Eurofins Genomics Goes Green
        • GENEius – Codon Usage Optimisation
        • 5 tips to speed up your qPCR
        • Why salt-free oligos are the unsung hero of molecular biology
  • Infos & Tools
    • Account
      • Infos & Tools
      • Account
        • Mein Profil
        • Bestellungen
        • Angebote
        • Gruppen
        • Einstellungen
        • Adressen
        • Dropboxen in der Nähe
        • Barcode Management
        • Sanger Kits & Barcodes
        • NGS Barcodes & Coupons
        • Genotyping Barcodes
        • Oligo Coupons
        • Primer / Cell Line Management
        • Sanger Proben & Primer
        • Zelllinien Management
    • Bezahloptionen
      • Infos & Tools
      • Bezahloptionen
        • EVOCARD Optionen
        • EVOcard Bezahlung
        • Neubestellung oder Aufladung EVOcard
    • Hilfe
      • Infos & Tools
      • Hilfe
        • Produkt FAQs
        • Video Anleitungen
        • GENEius
        • Excel Upload Formulare Oligos
        • Oligo Decision Tree
        • GATCViewer
    • Tools
      • Infos & Tools
      • Tools
        • Design Tools
        • Oligo Analyse Tool
        • PCR Primer Design Tool
        • Sequencing Primer Design Tool
    • Hilfe Center
      • Infos & Tools
      • Hilfe Center
        • NGS Probenversand
        • Wie sende ich meine NGS‑Proben ein?
        • Wie finde ich die nächstgelegene Dropbox‑Station?
        • Wie bestelle ich NGS‑Barcodes?
        • Wie sende ich Ersatzproben für NGS ein?
        • Wie bestelle ich ein UPS‑Label für den Versand meiner NGS‑Proben?
        • NGS Angebote
        • Wie fordere ich ein NGS‑Angebot an?
        • Wie akzeptiere ich ein NGS‑Angebot?
        • Bestellungen & Daten
        • Wie verwalte ich meine Bestellungen?
        • Wie verfolge ich den Status meiner NGS‑Probe
        • Wie greife ich auf meine NGS‑Daten zu
  • Über uns
    • Über uns
      • Über uns
      • Über uns
        • Über Eurofins
        • Karriere
        • Distributoren
        • Neuigkeiten
        • Schließzeiten der Labore
        • Events
        • Impressum
    • Qualitätssicherung
      • Über uns
      • Qualitätssicherung
        • Qualitätssicherung
    • Angebote und Aktionen
      • Über uns
      • Angebote und Aktionen
        • Alle Angebote und Aktionen
        • Services Kostenlos Testen
        • Gensynthese-Angebot
  • Kontakt
Login | Create Account
Header Image
 

Ultimate Precision Probes mit einem internen Quencher

  Intro & Info

Single-internal-quenched qPCR probes featuring enhanced quenching properties.
  • Internal quencher for highest quenching efficiency
  • In combination with a proprietary High Resolution HPLC purification method

Specifications:
  • Sequence length from 10 - 40 bases
  • Delivered dried at specified quantity or liquid at defined concentration
  • Selectable solvents are bidest water or TE buffer (10 mM Tris, 1 mM EDTA; pH=8)
  • An online QC Report including the MALDI-TOF MS traces is available free of charge
  • Additional services such as custom normalization or aliquoting are available upon request

How to request a quote:
First select the desired input format. The dyes and quencher and further options can be selected in the next step.
Place the internal quencher between the 9th and 10th base from the 5' sequence end.
Example: [FAM]ATCGATCGA[BHQ1INT]TCGATCGATCGATCG[PHO].
The 3’-phosphate modification is selected automatically and mandatory. Check your entries and then click on "Add to cart".

Sequence info:
ACGT = DNA; {ACGT} = LNA; I = 2’-Desoxyinosine; U = 2’-Desoxyuridine
Use the IUB code for wobble bases (equal amount of degenerated bases)

If you need an oligo modification which is not listed in the dropdown, please select "EXTRA [EXT]" and state the required modification in the production comment before you submit your quote request.

Special requests:
Additional services can be requested by describing your needs in the production comment. Our experts will create the right offer for you, which can be accepted online.

Please note:
Please order probes labeled with Cy3, Cy5 or Cy5.5 dry or dissolved in water, as they are only stable at pH 7. A higher pH would damage the dye and thus the probe. More information can be found in our Product FAQs.

Ultimate Precision Probes are recommended and optimised for qPCR analysis. For genotyping assays we recommend our Dual Labeled Probes.

Please let us know in the production comment section if you intend to use the requested probes directly in commercial kits to ensure that the offer is prepared accordingly.
 
  • Select your entry format
  • Specify your oligos
 

Entry Formats

Number of Oligos
 
Please select the number of oligos you want to order and press "Next".
You can always add more or leave lines empty on the next page.
 
 
Name and sequence can be pasted in one of the following formats (separated by a blank, tab, comma or semicolon):

Name1[blank]ACGTACGTACGTACGT
Name2[TAB]GTA TAG TAG TAG
Name3, act gct gct gcc
Name4; [FAM]actgctgaactgctgatgca

ACGT = DNA; {ACGT} = LNA; I = 2’-Desoxyinosine; U = 2’-Desoxyuridine

Modifications can be included in the DNA sequence at respective position by entering the designator (short name of the modification in square brackets). E.g.: [FAM]actgaagtacg[BHQ1INT]ctggatgagt
 
 
Next
 
Contact Us

TECHNICAL SUPPORT

Phone:

Mon-Fri:

Toll Free Phone Number:

E-Mail:

DETAILS

+49 (8092) 3379800
8 : 00 AM – 2 : 00 PM, ET
00800-200 100 20
support-eu@genomics.eurofinseu.com

QUOTES, PRICING & SPECIAL REQUESTS

Quotes are submitted, reviewed, and accepted through the online quoting tool. Learn more.
Please direct inquires about pricing and special project requests to your sales representative.
General questions: support-eu@genomics.eurofinseu.com

Change Region

  • Europe (current website)
  • America
  • India
  • Japan

We love hearing from our customers. Feel free to leave feedback.

Submit Feedback
Careers
  • ISO 9001
  • ISO 13485
  • ISO 17025

2026 - Copyright Eurofins Genomics

  • Terms & Conditions
  • Corporate
  • Privacy
  • Impressum
VEGA Beta