siMAX siRNA - The RNA Interfering Molecule                                            
progress bar
progress bar

eurofins eurofins

Email
Password
 
  
Forgot Password?
Create Account
 
 
  • Quick Order
  • 0

    Cart

  • Account
    • Login
    • Create Account
  • Products & Services
    • DNA / RNA Oligos
      • Products & Services
      • DNA / RNA Oligos
        • qPCR application oligos
        • PCR Primers
        • qPCR Probes
        • Ultimate Precision Probes
        • Next Generation Sequencing Oligos
        • NGSgrade Oligos
        • NGSgrade Oligos 2.0
        • NGS UDI Primer Sets
        • Sanger Sequencing Oligos
        • SeqPrimer
        • Standard Primers
        • Cloning applications & CRISPR
        • Cloning Oligo
        • EXTREmers
        • Custom DNA & RNA Oligos
        • Custom DNA Oligos
        • Salt Free Oligos
        • Custom RNA Oligos
        • siMAX siRNA
        • Large Scale Oligos
        • Special Requests
        • Oligo Design Tools
        • Oligo Analysis Tool
        • PCR Primer Design Tool
        • qPCR Assay Design Tool
        • Sequencing Primer Design Tool
        • Helpful Links
        • Oligo Decision Tree
        • Oligo Excel Upload Forms

        • Prepaid Oligo Coupons
          A Unique Prepayment Option for PCR - and Sequencing Primers
          Learn more

           

           

    • Gene Synthesis & Molecular Biology
      • Products & Services
      • Gene Synthesis & Molecular Biology
        • Synthetic genes
        • Standard Genes
        • Express Genes
        • Complex Genes
        • Gene synthesis project
        • Gene Fragments
        • GeneStrands
        • Express GeneStrands
        • Molecular Biology Services
        • Plasmid Preparation
        • Site Directed Mutagenesis
        • DNA Cloning
        • IVT mRNA
        • Optimisation tool
        • GENEius
    • Sanger Sequencing
      • Products & Services
      • Sanger Sequencing
        • Sequencing Services
        • Mix2Seq Services
        • LightRun Services
        • TubeSeq Supreme
        • PlateSeq Supreme
        • Direct Colony Sequencing
        • Prepaid Products
        • Mix2Seq Kits
        • LightRun Barcodes
        • Barcode Labels & Coupons
        • PlateSeq Kits
        • Shipping Options
        • Sequencing Accessories
        • Sample Shipment
        • Additional Services
        • Sequencing Primers
        • Free Barcode Labels
        • Special Sequencing Services
        • Sequence Verification and Primer Walking under ISO 17025 & GLP
        • �
          Mix2Seq Kit
          Fastest Sanger sequencing of premixed samples in tubes.

          Order Now

           

           

    • Nanopore Sequencing
      • Products & Services
      • Nanopore Sequencing
        • ONT Lite Portfolio - Products
        • Whole Plasmid Sequencing
        • Linear / Clonal Amplicons
        • Bacterial Genome Sequencing
        • Bacteria Assembly Hybrid
        • Yeast Genome Sequencing
        • ONT Lite - Additional Services
        • Prepaid ONT Coupons
        • Free barcodes
        • ONT Lite Assembly Review
        • Genome Sequencing (Full Flow Cells)
        • Human Whole Genome Sequencing
        • Bacteria Whole Genome Sequencing
        • Whole Genome Sequencing Non-Human
        • Amplicon Sequencing (Full Flow Cells)
        • Custom Long-Read Amplicon Sequencing
        • 16S Full-Length Microbiome
        • Prepaid ONT Lite Coupons
          A Unique Prepayment Option for your sequencing with Oxford Nanopore

          Learn more

           

           

    • Next Generation Sequencing
      • Products & Services
      • Next Generation Sequencing
        • Genome Sequencing
        • Human WGS
        • Non-human WGS
        • INVIEW Resequencing
        • Mammal WGS
        • Microbiome & Metagenome
        • INVIEW Microbiome
        • INVIEW Metagenome
        • Amplicon Sequencing
        • Amplicon sequencing
        • Amplicon sequencing - incl. amplification
        • Transcriptome
        • INVIEW Transcriptome
        • INVIEW Transcriptome Bacteria
        • NGSelect RNA
        • Single Cell RNA Sequencing
        • Exome & Enrichment
        • INVIEW Exome
        • Clinical Research Exome
        • INVIEW Oncoprofiling
        • INVIEW Liquid Biopsy Oncoprofiling
        • Bioinformatic Services
        • RNA-Seq Analysis
        • Variant Analysis Service
        • Metagenome Analysis Service
        • Microbiome Profiling Analysis
        • Prepaid Coupons and free Barcodes
        • Free Barcodes
        • NGS Prepaid Coupons
        • Important information
        • Sample Submission Guidelines
        • NGS Publications
        • Request for Information
        • Special applications
        • INVIEW Virus
        • Ready-to-Load
        • Prepaid NGS Coupons

           

          A Unique Prepayment Option for our NGS Services

          Learn more

           

           

    • Genotyping & Genexpression
      • Products & Services
      • Genotyping & Genexpression
        • Applied Genomic Services
        • DNA Barcoding
        • Cell Line Authentication
        • Mycoplasmacheck
        • Fragment Length Analysis
        • Genotyping Services
        • SNP Genotyping
        • Copy Number Variation
        • Mikrosatellites/ STR/FLA/ IDAA
        • Gene Expression Services
        • Transcriptome analysis
        • Expression Arrays
        • Target Gene Expression
  • Markets
    • All Markets
    • Pharma / Biotech
      • Markets
      • Pharma / Biotech
        • Overview
        • Pharma Portfolio
        • Oncology Portfolio
        • Synthesis Products
        • Industrial-grade NGS Oligos
        • Ultimate Precision Probes
        • Special Oligo Requests
        • Large Scale Oligos
        • Gene Synthesis
        • Gene Fragments
        • Sequencing Services
        • Exome Sequencing
        • Transcriptome Sequencing
        • Genome Sequencing
        • Bioinformatic Solutions for NGS
        • Favorite Content
        • NGS - Disease Diagnostics
        • Cancer Ecology
        • Personalised Cancer Therapy
        • Revolutionising human-like-protein production
        • The Microbiome Of Cancer
        • All about biomarker discovery
    • Agrigenomics
      • Markets
      • Agrigenomics
        • Overview
        • Agrigenomics Portfolio
        • Plant Breeder
        • DNA marker discovery
        • Marker-assisted selection
        • GRAS-Di®
        • Microbiome and metagenomics
        • Animal Breeder
        • DNA Marker discovery
        • Pathogen screening
        • Parentage testing
        • Genomic selection
        • Marker-assisted selection
        • Webshop - GenFarmEval
        • Favorite Content
        • Microarrays Accelerate Blue Biotechnology
        • How To Do NGS 50% Faster
        • NGS Portfolio
        • GenFarmEval.com

          Visit our Webshop for Farmers

    • Consumer Genomics
      • Markets
      • Consumer Genomics
        • Overview
        • Consumer Genomics Portfolio
        • Sequencing Services
        • Genotyping
        • Epigenome Profiling
        • Microbiome Analysis
        • Shotgun Sequencing
        • Whole Genome Sequencing
        • Additional Services
        • Sample Collection Kits
        • Shipping
        • DNA Extraction
        • Laboratory Service
        • Biobanking
        • Favorite Content
        • Population Genetics
        • The End of Gene Doping
        • Home Genomics Testing
        • IVDR Compliance
    • Food & Environment
      • Markets
      • Food & Environment
        • Overview
        • Food & Environment Portfolio
        • Food Testing
        • Food Authenticity
        • Meat Traceability
        • Pathogen Traceability
        • Environmental Testing
        • Non-targeted detection of organisms / species
        • Targeted detection of organisms / species
        • eDNA Tracker
        • Favorite Content
        • Determine the Source of Meat
        • Pine Nuts – Why Testing For Edibility Matters
    • Diagnostic Kit Producer
      • Markets
      • Diagnostic Kit Producer
        • Overview
        • Kit Producer Portfolio
        • Synthesis Products
        • Large Scale Oligos
        • Special Requests in Tubes
        • Quality Assurance
        • GLP
        • ISO 17025
        • ISO 13485
        • Favorite Content
        • Oligonucleotides For Diagnostics
        • The Future of RNA Applications
    • Research / Biotech
      • Markets
      • Research / Biotech
        • Overview
        • Research Portfolio
        • Favorite Services
        • Custom DNA Oligos
        • TubeSeq Service Sanger
        • INVIEW Microbiome NGS
        • NGS Services
        • GeneStrands
        • Express Services
        • Mix2Seq NightXpress
        • Express Genes
        • Express GeneStrands
        • Favorite Content
        • Eurofins Genomics Goes Green
        • GENEius – Codon Usage Optimisation
        • 5 tips to speed up your qPCR
        • Why salt-free oligos are the unsung hero of molecular biology
  • Resources
    • Account
      • Resources
      • Account
        • My profile
        • Orders
        • Quotes
        • Groups
        • Preferences
        • Addresses
        • Dropboxes Nearby
        • Barcode Management
        • Sanger Barcode Management
        • NGS Barcode Management
        • Genotyping Barcode Management
        • Oligo Barcode Management
        • Primer / Cell Line Management
        • Sanger Sequencing Primers
        • Cell Line Management
    • Solutions
      • Resources
      • Solutions
        • EVOCARD Options
        • EVOcard Payment Method
        • Order or Refill EVOcards
        •  

    • Other Resources
      • Resources
      • Other Resources
        • Frequently Asked Questions (FAQs)
        • Video Tutorials
        • GENEius
        • Excel Upload Forms Oligos
        • GATCViewer
    • Tools
      • Resources
      • Tools
        • Design tools
        • PCR Primer Design Tool
        • Sequencing Primer Design Tool
        • Oligo Analysis Tool
  • About us
    • About Us
      • About us
      • About Us
        • About Eurofins
        • Careers
        • Distributors
        • News
        • Events
        • Holiday Hours
        • Imprint
    • Quality Control
      • About us
      • Quality Control
        • Quality Assurance
    • Promotions
      • About us
      • Promotions
        • View all promotions
        • End-of-Year Promotion
        • Test our Services for Free
  • Contact
Logo
  • Products & Services
    • DNA / RNA Oligos
      • Products & Services
      • DNA / RNA Oligos
        • qPCR application oligos
        • PCR Primers
        • qPCR Probes
        • Ultimate Precision Probes
        • Next Generation Sequencing Oligos
        • NGSgrade Oligos
        • NGSgrade Oligos 2.0
        • NGS UDI Primer Sets
        • Sanger Sequencing Oligos
        • SeqPrimer
        • Standard Primers
        • Cloning applications & CRISPR
        • Cloning Oligo
        • EXTREmers
        • Custom DNA & RNA Oligos
        • Custom DNA Oligos
        • Salt Free Oligos
        • Custom RNA Oligos
        • siMAX siRNA
        • Large Scale Oligos
        • Special Requests
        • Oligo Design Tools
        • Oligo Analysis Tool
        • PCR Primer Design Tool
        • qPCR Assay Design Tool
        • Sequencing Primer Design Tool
        • Helpful Links
        • Oligo Decision Tree
        • Oligo Excel Upload Forms

        • Prepaid Oligo Coupons
          A Unique Prepayment Option for PCR - and Sequencing Primers
          Learn more

           

           

    • Gene Synthesis & Molecular Biology
      • Products & Services
      • Gene Synthesis & Molecular Biology
        • Synthetic genes
        • Standard Genes
        • Express Genes
        • Complex Genes
        • Gene synthesis project
        • Gene Fragments
        • GeneStrands
        • Express GeneStrands
        • Molecular Biology Services
        • Plasmid Preparation
        • Site Directed Mutagenesis
        • DNA Cloning
        • IVT mRNA
        • Optimisation tool
        • GENEius
    • Sanger Sequencing
      • Products & Services
      • Sanger Sequencing
        • Sequencing Services
        • Mix2Seq Services
        • LightRun Services
        • TubeSeq Supreme
        • PlateSeq Supreme
        • Direct Colony Sequencing
        • Prepaid Products
        • Mix2Seq Kits
        • LightRun Barcodes
        • Barcode Labels & Coupons
        • PlateSeq Kits
        • Shipping Options
        • Sequencing Accessories
        • Sample Shipment
        • Additional Services
        • Sequencing Primers
        • Free Barcode Labels
        • Special Sequencing Services
        • Sequence Verification and Primer Walking under ISO 17025 & GLP
        • �
          Mix2Seq Kit
          Fastest Sanger sequencing of premixed samples in tubes.

          Order Now

           

           

    • Nanopore Sequencing
      • Products & Services
      • Nanopore Sequencing
        • ONT Lite Portfolio - Products
        • Whole Plasmid Sequencing
        • Linear / Clonal Amplicons
        • Bacterial Genome Sequencing
        • Bacteria Assembly Hybrid
        • Yeast Genome Sequencing
        • ONT Lite - Additional Services
        • Prepaid ONT Coupons
        • Free barcodes
        • ONT Lite Assembly Review
        • Genome Sequencing (Full Flow Cells)
        • Human Whole Genome Sequencing
        • Bacteria Whole Genome Sequencing
        • Whole Genome Sequencing Non-Human
        • Amplicon Sequencing (Full Flow Cells)
        • Custom Long-Read Amplicon Sequencing
        • 16S Full-Length Microbiome
        • Prepaid ONT Lite Coupons
          A Unique Prepayment Option for your sequencing with Oxford Nanopore

          Learn more

           

           

    • Next Generation Sequencing
      • Products & Services
      • Next Generation Sequencing
        • Genome Sequencing
        • Human WGS
        • Non-human WGS
        • INVIEW Resequencing
        • Mammal WGS
        • Microbiome & Metagenome
        • INVIEW Microbiome
        • INVIEW Metagenome
        • Amplicon Sequencing
        • Amplicon sequencing
        • Amplicon sequencing - incl. amplification
        • Transcriptome
        • INVIEW Transcriptome
        • INVIEW Transcriptome Bacteria
        • NGSelect RNA
        • Single Cell RNA Sequencing
        • Exome & Enrichment
        • INVIEW Exome
        • Clinical Research Exome
        • INVIEW Oncoprofiling
        • INVIEW Liquid Biopsy Oncoprofiling
        • Bioinformatic Services
        • RNA-Seq Analysis
        • Variant Analysis Service
        • Metagenome Analysis Service
        • Microbiome Profiling Analysis
        • Prepaid Coupons and free Barcodes
        • Free Barcodes
        • NGS Prepaid Coupons
        • Important information
        • Sample Submission Guidelines
        • NGS Publications
        • Request for Information
        • Special applications
        • INVIEW Virus
        • Ready-to-Load
        • Prepaid NGS Coupons

           

          A Unique Prepayment Option for our NGS Services

          Learn more

           

           

    • Genotyping & Genexpression
      • Products & Services
      • Genotyping & Genexpression
        • Applied Genomic Services
        • DNA Barcoding
        • Cell Line Authentication
        • Mycoplasmacheck
        • Fragment Length Analysis
        • Genotyping Services
        • SNP Genotyping
        • Copy Number Variation
        • Mikrosatellites/ STR/FLA/ IDAA
        • Gene Expression Services
        • Transcriptome analysis
        • Expression Arrays
        • Target Gene Expression
  • Markets
    • All Markets
    • Pharma / Biotech
      • Markets
      • Pharma / Biotech
        • Overview
        • Pharma Portfolio
        • Oncology Portfolio
        • Synthesis Products
        • Industrial-grade NGS Oligos
        • Ultimate Precision Probes
        • Special Oligo Requests
        • Large Scale Oligos
        • Gene Synthesis
        • Gene Fragments
        • Sequencing Services
        • Exome Sequencing
        • Transcriptome Sequencing
        • Genome Sequencing
        • Bioinformatic Solutions for NGS
        • Favorite Content
        • NGS - Disease Diagnostics
        • Cancer Ecology
        • Personalised Cancer Therapy
        • Revolutionising human-like-protein production
        • The Microbiome Of Cancer
        • All about biomarker discovery
    • Agrigenomics
      • Markets
      • Agrigenomics
        • Overview
        • Agrigenomics Portfolio
        • Plant Breeder
        • DNA marker discovery
        • Marker-assisted selection
        • GRAS-Di®
        • Microbiome and metagenomics
        • Animal Breeder
        • DNA Marker discovery
        • Pathogen screening
        • Parentage testing
        • Genomic selection
        • Marker-assisted selection
        • Webshop - GenFarmEval
        • Favorite Content
        • Microarrays Accelerate Blue Biotechnology
        • How To Do NGS 50% Faster
        • NGS Portfolio
        • GenFarmEval.com

          Visit our Webshop for Farmers

    • Consumer Genomics
      • Markets
      • Consumer Genomics
        • Overview
        • Consumer Genomics Portfolio
        • Sequencing Services
        • Genotyping
        • Epigenome Profiling
        • Microbiome Analysis
        • Shotgun Sequencing
        • Whole Genome Sequencing
        • Additional Services
        • Sample Collection Kits
        • Shipping
        • DNA Extraction
        • Laboratory Service
        • Biobanking
        • Favorite Content
        • Population Genetics
        • The End of Gene Doping
        • Home Genomics Testing
        • IVDR Compliance
    • Food & Environment
      • Markets
      • Food & Environment
        • Overview
        • Food & Environment Portfolio
        • Food Testing
        • Food Authenticity
        • Meat Traceability
        • Pathogen Traceability
        • Environmental Testing
        • Non-targeted detection of organisms / species
        • Targeted detection of organisms / species
        • eDNA Tracker
        • Favorite Content
        • Determine the Source of Meat
        • Pine Nuts – Why Testing For Edibility Matters
    • Diagnostic Kit Producer
      • Markets
      • Diagnostic Kit Producer
        • Overview
        • Kit Producer Portfolio
        • Synthesis Products
        • Large Scale Oligos
        • Special Requests in Tubes
        • Quality Assurance
        • GLP
        • ISO 17025
        • ISO 13485
        • Favorite Content
        • Oligonucleotides For Diagnostics
        • The Future of RNA Applications
    • Research / Biotech
      • Markets
      • Research / Biotech
        • Overview
        • Research Portfolio
        • Favorite Services
        • Custom DNA Oligos
        • TubeSeq Service Sanger
        • INVIEW Microbiome NGS
        • NGS Services
        • GeneStrands
        • Express Services
        • Mix2Seq NightXpress
        • Express Genes
        • Express GeneStrands
        • Favorite Content
        • Eurofins Genomics Goes Green
        • GENEius – Codon Usage Optimisation
        • 5 tips to speed up your qPCR
        • Why salt-free oligos are the unsung hero of molecular biology
  • Resources
    • Account
      • Resources
      • Account
        • My profile
        • Orders
        • Quotes
        • Groups
        • Preferences
        • Addresses
        • Dropboxes Nearby
        • Barcode Management
        • Sanger Barcode Management
        • NGS Barcode Management
        • Genotyping Barcode Management
        • Oligo Barcode Management
        • Primer / Cell Line Management
        • Sanger Sequencing Primers
        • Cell Line Management
    • Solutions
      • Resources
      • Solutions
        • EVOCARD Options
        • EVOcard Payment Method
        • Order or Refill EVOcards
        •  

    • Other Resources
      • Resources
      • Other Resources
        • Frequently Asked Questions (FAQs)
        • Video Tutorials
        • GENEius
        • Excel Upload Forms Oligos
        • GATCViewer
    • Tools
      • Resources
      • Tools
        • Design tools
        • PCR Primer Design Tool
        • Sequencing Primer Design Tool
        • Oligo Analysis Tool
  • About us
    • About Us
      • About us
      • About Us
        • About Eurofins
        • Careers
        • Distributors
        • News
        • Events
        • Holiday Hours
        • Imprint
    • Quality Control
      • About us
      • Quality Control
        • Quality Assurance
    • Promotions
      • About us
      • Promotions
        • View all promotions
        • End-of-Year Promotion
        • Test our Services for Free
  • Contact
Login | Create Account

siMAX siRNA - Customised siRNA

  • You are here:
  • DNA & RNA|Oligonucleotides >
  • Custom DNA & RNA Oligos >
  • siMAX siRNA

 

 

siMAX siRNA - Maximum gene silencing with siMAX small interfering RNA

 

The purpose of siRNAs is to silence several types of RNA. siRNA is a class of double-stranded RNA molecules. It plays an important role in the RNA interference (RNAi) pathway, where it interferes with the expression of specific genes with complementary nucleotide sequence.

 

Order your Custom siRNA Oligonucleotide

 

Highlights of our siMAX siRNA

 

We offer custom siRNAs annealed and ready-to-use:

 

  • Guaranteed purity of 85 % (HPLC purified)
  • Fix quantity of 20 nmol or 40 nmol
  • Sequence lengths: 17 - 27 bases
  • Quality control by MALDI-TOF MS
  • Turnaround time: 8 - 10 working days
  • Delivery: lyophilised in 2 ml screw cap tubes


Additional online features free of charge:

  • Selectable label layouts for your oligo tubes
  • Antisense sequence calculator
  • Online order status and delivery tracking

 

A free 1ml 5x siMAX dilution buffer (30 mM HEPES, 100 mM KCl, 1 mM MgCl2, pH = 7.3) is included with each shipment.

 

21mer versus 27mer siRNA


21mer siRNA molecules are synthesised with either dTdT overhangs or alternate overhangs defined by you:

 

21mer siRNA

 


27mer siRNA may show a much higher efficacy than 21mer siRNAs
.


27mer siRNA, also known as Dicer-substrate RNAs, is reported to be significantly more potent than the traditional 21mer siRNA by taking advantage of Dicer's natural processing. These dsiRNA molecules can also be chemically synthesized. The structure of these RNA duplexes is shown below:

27mer siRNA

 

 

>> FAQ's Oligonucleotides

>> Custom RNA Oligos

>> Custom DNA Oligos

>> Special Requests

 

 

Related Information

 

 

Resuspension & Annealing

To resuspend the siMAX siRNA duplex


Avoid RNA degradation by using special precautions and by wearing protective lab clothing and gloves. All solutions should be qualified as RNAase-free and reserved only for use in RNA experiments. All RNA work spaces must be free of RNAase contamination. Add the required volume by using the provided siRNA dilution buffer to create your stock solution. Buffer must be diluted with RNase-free water prior to use. 


Annealing


The delivered siRNAs are annealed and ready to use. But if you want to repeat the annealing step:

  • Heat the tube to 90°C for 60 - 90 sec
  • Incubate at 37°C for at least one hour

 

siMAX siRNA controls

Select the sense strand of your preferred siRNA control for copying it into the siMAX siRNA order page.

 

siRNA control Sequence

Lamin A/C µmol

CUGGACUUCCAGAAGAACA

Lamin B2

GAGGAGGAGGAAGCCGAGU

GAPDH

AUUCCAUGGCACCGUCAAG

Luciferase GL2

CGUACGCGGAAUACUUCGA

Luciferase GL3

CUUACGCUGAGUACUUCGA

Green Fluorescent Protein

GGCUACGUCCAGGAGCGCACC

Non Specific Control 31% GC

UAAUGUAUUGGAACGCAUA

Non Specific Control 47% GC

AGGUAGUGUAAUCGCCUUG

Non Specific Control 68% GC

UGCGCUAGGCCUCGGUUGC

 

 

 

 

 

 

 

 

Quality is important for us at Eurofins

Our products and services are produced and performed under strict quality management and quality assurance systems.

Find certificates here
Contact Us

TECHNICAL SUPPORT

Phone: +49 (8092) 3379800

Toll Free Phone Number: 00800-200 100 20

E-Mail: support-eu@genomics.eurofinseu.com

HOURS

Mon-Thu: 8 : 00 AM – 5 : 00 PM, ET

Friday: 8 : 00 AM – 4 : 00 PM, ET

QUOTES, PRICING & SPECIAL REQUESTS

Quotes are submitted, reviewed, and accepted through the online quoting tool. Learn more.
Please direct inquires about pricing and special project requests to your sales representative.
General questions: support-eu@genomics.eurofinseu.com

Change Region

  • Europe (current website)
  • America
  • India
  • Japan

We love hearing from our customers. Feel free to leave feedback.

Submit Feedback
Careers
  • ISO 9001
  • ISO 13485
  • ISO 17025

2025 - Copyright Eurofins Genomics

  • Terms & Conditions
  • Corporate
  • Privacy
  • Imprint
VEGA Beta