Typical Applications are:

What you can expect from our NGSgrade Oligos 2.0

• Typical cross contamination rate of 0.01% - 0.05% determined by our NGS lab (see cross-contamination rate)
• Available minimum quantities of 4 nmol, 10 nmol and 25 nmol
• DNA sequence length from 15 - 120 bases
• Available modifications are PTO bounds, 2’-Desoxyinosine, 2’-Desoxyuridine and 5’-Phosphate
• Quality is ensured by OD measurement and ESI-MS (electrospray ionization mass spectrometry)
• An online quality report, including the ESI-MS spectra, can be ordered
• Selectable solvents are bidest water, TE buffer (10 mM Tris, 1 mM EDTA; pH=8) or Low EDTA Puffer (10 mM Tris, 0.1 mM EDTA pH = 8)
• Fast delivery times from 8 working days

For delivery in tubes:

• Oligos are supplied in 2ml screw cap tubes either lyophilized or in liquid form at the selected concentration

For delivery in plates:

• Oligos are supplied in the selected 96well plate in liquid form at the defined concentration
• A minimum of 20 oligos per 96-well plate is required

Why low cross-contamination matters

In multiplex sequencing workflows, contamination from co-synthesized index primers can contribute to read misassignment and reduced confidence in downstream analysis.

NGSgrade Oligos 2.0 are specifically engineered to minimize these risks and help ensure maximum sequencing accuracy.

The cross-contamination rate of 0.01 – 0.05% was determined by sequencing representative sets of Unique Dual Index (UDI) primer pairs using Illumina instruments at Eurofins Genomics’ European NGS sequencing facility. The rate given represents the typical total percentage of read pairs not matching the expected UDI combinations for a set of 96 UDI primer pairs. The corresponding Application Note shows a cross-contamination rate of 0.0014% for a set of 14 UDI primer pairs.

Please note that the total cross-contamination rate (percentage of incorrectly assigned read pairs) is influenced by the total amount of UDI primer pairs analysed in parallel. The more UDI primers are analysed, the higher the total cross-contamination can get, as more unexpected index combinations can be attributed.

In all cases, the actual cross-contamination of primers would be even lower as stated above. This is because the association of reads with other unexpected UDI primer pairs is a result of primer cross-contamination and index hopping during sequencing. Discriminating between these causes is not possible in this analysis setup.

Please note that Eurofins Genomics does not determine the cross-contamination rate for each individual set of NGS oligonucleotides produced and shipped.

Product Data

Eurofins Genomics uses a new and proprietary synthesis device to produce high performance NGSgrade 2.0 oligonucleotides. This equipment enables best-in-class coupling efficiencies, resulting in a high percentage of non-truncated, full-length oligonucleotides.

Figure 1. Theoretical purities for NGSgrade 2.0 oligonucleotides. (A) Plot of theoretical purities for different lengths of oligos applying a coupling rate of 99.6%. This average coupling rate was determined based on a large and representative sample of data points. (B) Example IP-RP-HPLC-chromatogram for a UDI adapter primer of 72 nucleotides, recorded at λ = 260 nm. A purity of 74.0% was measured for the target product. Analytical IP-RP UHPLC was performed on a Vanquish Horizon Duo system from ThermoFisher Scientific.

Adapter Ligation Oligos for NGS amplicon sequencing on NovaSeq

High quality adapter oligos to improve multiplexing with sample tagging by NGS on Illumina. They are designed and validated by our in-house NextGen sequencing lab:

• 192 individual designed tags are available to label your samples
• Each tag consist of 10 nucleotides which will be added to your template specific forward primer*.
• The tags are designed with a minimum edit distance of 4, which prevents in a best possible way mis-assignments in case of sequencing errors
• Tags are optimised for sample pools with low and high amount of samples
• All NGSgrade Oligos undergo a specific cross-contamination free processes to guarantee best purity and performance

Please use our Excel template provided on the NGSgrade 2.0 Oligo order page, which is specifically coded for designing your amplicon adaptor ligation oligos.

The designed primers can be used for our NGSelect Amplicon Adaptor Ligation product or with your own sequencing protocol.

*For e.g. multiplexing of 24 samples with the same target specific sequence, the same forward primer sequence must be used 24 times and one reverse primer. On each forward primer the design tool will add a different tag. The reverse primer will not get tags.

2nd PCR Oligos for NGS amplicon sequencing on MiSeq

Amplicon 2nd PCR Oligos are specifically designed to enable sample pooling for NGS on Illumina platforms. They are developed and validated by our in-house NextGen sequencing lab.

When performing NGS amplicon sequencing on MiSeq, primers with universal adaptors are required for the first PCR.

For your convenience, Eurofins Genomics automatically adds these adaptors to your target-specific sequences. This automated process during online ordering ensures that your primers have the correct, validated, and optimized design. To facilitate this, please use our Excel template, available on the NGSgrade 2.0 Oligo order page.

Adaptor sequences:

• Forward Primer Sequence: ACACTCTTTCCCTACACGACGCTCTTCCGATCT
• Reverse Primer Sequence: GACTGGAGTTCAGACGTGTGCTCTTCCGATCT

The designed primers are compatible with our NGSelect Amplicon MiSeq service.

What you can expect from our NGSgrade Oligos

Optimised and verified product specifications:

• Guaranteed purity of > 80% by HPLC purification
• Specific cross-contamination free processes after synthesis
• Stringent quality criteria checked by MALDI-TOF MS
• Synthesis scales from 0.01 to 1.0 µmol
• Selectable delivery format: lyophilised and concentration adjusted
• Delivery time: 
  • 5-7 working days for up to 60 mers
  • 10 working days for > 61 mers

Minimum yields (OD) per scale:

 The synthesis scale indicates the initial amout of 3'-bases. 

Additional online features free of charge

• Add a personal note to your oligo resp. plate
• Calculate the complementary sequence
• Select your preferred label layout for your oligo tubes
• Track production and delivery status online
• View your order history under "My Orders