NGSgrade Oligos for MiSeq                                            
progress bar
progress bar

eurofins eurofins

Email
Password
 
  
Forgot Password?
Create Account
 
 
  • Quick Order
  • 0

    Cart

  • Account
    • Login
    • Create Account
  • Products & Services
    • DNA / RNA Oligos
      • Products & Services
      • DNA / RNA Oligos
        • qPCR application oligos
        • PCR Primers
        • qPCR Probes
        • Ultimate Precision Probes
        • Next Generation Sequencing Oligos
        • NGSgrade Oligos
        • NGSgrade Oligos 2.0
        • NGS UDI Primer Sets
        • Sanger Sequencing Oligos
        • SeqPrimer
        • Standard Primers
        • Cloning applications & CRISPR
        • Cloning Oligo
        • EXTEmers
        • Custom DNA & RNA Oligos
        • Custom DNA Oligos
        • Salt Free Oligos
        • Custom RNA Oligos
        • siMAX siRNA
        • Large Scale Oligos
        • Special Requests
        • Oligo Design Tools
        • Oligo Analysis Tool
        • PCR Primer Design Tool
        • qPCR Assay Design Tool
        • Sequencing Primer Design Tool

        • Prepaid Oligo Coupons
          A Unique Prepayment Option for PCR - and Sequencing Primers
          Learn more

           

           

    • Gene Synthesis & Molecular Biology
      • Products & Services
      • Gene Synthesis & Molecular Biology
        • Synthetic genes
        • Standard Genes
        • Express Genes
        • Complex Genes
        • Gene synthesis project
        • Gene Fragments
        • GeneStrands
        • Express GeneStrands
        • Molecular Biology Services
        • Plasmid Preparation
        • Site Directed Mutagenesis
        • DNA Cloning
        • Optimisation tool
        • GENEius
    • Sanger Sequencing
      • Products & Services
      • Sanger Sequencing
        • Sequencing Services
        • Mix2Seq Services
        • LightRun Services
        • TubeSeq Supreme
        • PlateSeq Supreme
        • Direct Colony Sequencing
        • Prepaid Products
        • Mix2Seq Kits
        • LightRun Barcodes
        • Barcode Labels & Coupons
        • PlateSeq Kits
        • Special Sequencing Services
        • Primer Walking Service
        • Shipping Options
        • Sequencing Accessories
        • Sample Shipment
        • Additional Services
        • Sequencing Primers
        • Free Barcode Labels
        • �
          Mix2Seq Kit
          Fastest Sanger sequencing of premixed samples in tubes.

          Order Now

           

           

    • Nanopore Sequencing
      • Products & Services
      • Nanopore Sequencing
        • ONT Lite Portfolio
        • Whole Plasmid Sequencing
        • Linear / Clonal Amplicons
        • Bacterial Genome Sequencing
        • Bacteria Assembly Hybrid
        • Yeast Genome Sequencing
        • Prepaid ONT Coupons
        • Free barcodes
        • Genome Sequencing
        • Human Whole Genome Sequencing
        • Bacteria Whole Genome Sequencing
        • Whole Genome Sequencing Non-Human
        • Amplicon Sequencing
        • Custom Long-Read Amplicon Sequencing
        • 16S Full-Length Microbiome
        • Prepaid ONT Lite Coupons
          A Unique Prepayment Option for your sequencing with Oxford Nanopore

          Learn more

           

           

    • Next Generation Sequencing
      • Products & Services
      • Next Generation Sequencing
        • Genome Sequencing
        • Human WGS
        • Non-human WGS
        • INVIEW Resequencing
        • Microbiome & Metagenome
        • INVIEW Microbiome
        • INVIEW Metagenome
        • Amplicon Sequencing
        • Amplicon sequencing
        • Amplicon sequencing - incl. amplification
        • Transcriptome
        • INVIEW Transcriptome
        • INVIEW Transcriptome Bacteria
        • NGSelect RNA
        • Exome & Enrichment
        • INVIEW Exome
        • Clinical Research Exome
        • INVIEW Oncoprofiling
        • INVIEW Liquid Biopsy Oncoprofiling
        • Bioinformatic Services
        • RNA-Seq Analysis
        • Variant Analysis Service
        • Metagenome Analysis Service
        • Microbiome Profiling Analysis
        • Prepaid Coupons and free Barcodes
        • Free Barcodes
        • NGS Prepaid Coupons
        • Important information
        • Sample Submission Guidelines
        • NGS Publications
        • Special applications
        • INVIEW CRISPR Check
        • INVIEW Virus
        • Prepaid NGS Coupons

           

          A Unique Prepayment Option for our NGS Services

          Learn more

           

           

    • Genotyping & Genexpression
      • Products & Services
      • Genotyping & Genexpression
        • Applied Genomic Services
        • DNA Barcoding
        • Cell Line Authentication
        • Mycoplasmacheck
        • Fragment Length Analysis
        • Genotyping Services
        • SNP Genotyping
        • Copy Number Variation
        • Mikrosatellites/ STR/FLA/ IDAA
        • Gene Expression Services
        • Transcriptome analysis
        • Expression Arrays
        • Target Gene Expression
  • Markets
    • Pharma / Biotech
      • Markets
      • Pharma / Biotech
        • Synthesis Products
        • Industrial-grade NGS Oligos
        • Ultimate Precision Probes
        • Special Oligo Requests
        • Large Scale Oligos
        • Gene Synthesis
        • Gene Fragments
        • Sequencing Services
        • Exome Sequencing
        • Transcriptome Sequencing
        • Genome Sequencing
        • Bioinformatic Solutions for NGS
        • Favorite Content
        • NGS - Disease Diagnostics
        • Cancer Ecology
        • Personalised Cancer Therapy
        • Revolutionising human-like-protein production
        • The Microbiome Of Cancer
        • All about biomarker discovery
    • Agrigenomics
      • Markets
      • Agrigenomics
        • Plant Breeder
        • DNA marker discovery
        • Marker-assisted selection
        • GRAS-Di®
        • Microbiome and metagenomics
        • Animal Breeder
        • DNA Marker discovery
        • Pathogen screening
        • Parentage testing
        • Genomic selection
        • Marker-assisted selection
        • Webshop - GenFarmEval
        • Favorite Content
        • Microarrays Accelerate Blue Biotechnology
        • How To Do NGS 50% Faster
        • NGS Portfolio
        • GenFarmEval.com

          Visit our Webshop for Farmers

          learn more

    • Consumer Genomics
      • Markets
      • Consumer Genomics
        • Sequencing Services
        • Genotyping
        • Epigenome Profiling
        • Microbiome Analysis
        • Shotgun Sequencing
        • Whole Genome Sequencing
        • Additional Services
        • Sample Collection Kits
        • Shipping
        • DNA Extraction
        • Laboratory Service
        • Biobanking
        • Favorite Content
        • Population Genetics
        • The End of Gene Doping
        • Home Genomics Testing
        • IVDR Compliance
    • Food & Environment
      • Markets
      • Food & Environment
        • Food Testing
        • Food Authenticity
        • Meat Traceability
        • Pathogen Traceability
        • Cannabis and Hemp Testing
        • Environmental Testing
        • Non-targeted detection of organisms / species
        • Targeted detection of organisms / species
        • eDNA Tracker
        • Favorite Content
        • Determine the Source of Meat
        • Pine Nuts – Why Testing For Edibility Matters
    • Diagnostic Kit Producer
      • Markets
      • Diagnostic Kit Producer
        • Synthesis Products
        • Large Scale Oligos
        • Special Requests in Tubes
        • Quality Assurance
        • GLP
        • ISO 17025
        • ISO 13485
        • Favorite Content
        • Oligonucleotides For Diagnostics
        • The Future of RNA Applications
    • Research / Biotech
      • Markets
      • Research / Biotech
        • Favorite Services
        • Custom DNA Oligos
        • TubeSeq Service Sanger
        • INVIEW Microbiome NGS
        • NGS Services
        • GeneStrands
        • Express Services
        • Mix2Seq NightXpress
        • Express Genes
        • Express GeneStrands
        • Favorite Content
        • Eurofins Genomics Goes Green
        • GENEius – Codon Usage Optimisation
        • 5 tips to speed up your qPCR
        • Why salt-free oligos are the unsung hero of molecular biology
  • Resources
    • Account
      • Resources
      • Account
        • My profile
        • Orders
        • Quotes
        • Groups
        • Preferences
        • Addresses
        • Dropboxes Nearby
        • Barcode Management
        • Sanger Barcode Management
        • NGS Barcode Management
        • Genotyping Barcode Management
        • Oligo Barcode Management
        • Primer / Cell Line Management
        • Sanger Sequencing Primers
        • Cell Line Management
    • Solutions
      • Resources
      • Solutions
        • EVOCARD Options
        • EVOcard Payment Method
        • Order or Refill EVOcards
        •  

    • Other Resources
      • Resources
      • Other Resources
        • Frequently Asked Questions (FAQs)
        • Video Tutorials
        • GENEius
        • Excel Upload Forms Oligos
    • Tools
      • Resources
      • Tools
        • Design tools
        • PCR Primer Design Tool
        • Sequencing Primer Design Tool
        • Oligo Analysis Tool
  • About us
    • About Us
      • About us
      • About Us
        • About Eurofins
        • Careers
        • Distributors
        • News
        • Holiday Hours
    • Quality Control
      • About us
      • Quality Control
        • Quality Assurance
    • Promotions
      • About us
      • Promotions
        • View all promotions
  • Contact
Logo
  • Products & Services
    • DNA / RNA Oligos
      • Products & Services
      • DNA / RNA Oligos
        • qPCR application oligos
        • PCR Primers
        • qPCR Probes
        • Ultimate Precision Probes
        • Next Generation Sequencing Oligos
        • NGSgrade Oligos
        • NGSgrade Oligos 2.0
        • NGS UDI Primer Sets
        • Sanger Sequencing Oligos
        • SeqPrimer
        • Standard Primers
        • Cloning applications & CRISPR
        • Cloning Oligo
        • EXTEmers
        • Custom DNA & RNA Oligos
        • Custom DNA Oligos
        • Salt Free Oligos
        • Custom RNA Oligos
        • siMAX siRNA
        • Large Scale Oligos
        • Special Requests
        • Oligo Design Tools
        • Oligo Analysis Tool
        • PCR Primer Design Tool
        • qPCR Assay Design Tool
        • Sequencing Primer Design Tool

        • Prepaid Oligo Coupons
          A Unique Prepayment Option for PCR - and Sequencing Primers
          Learn more

           

           

    • Gene Synthesis & Molecular Biology
      • Products & Services
      • Gene Synthesis & Molecular Biology
        • Synthetic genes
        • Standard Genes
        • Express Genes
        • Complex Genes
        • Gene synthesis project
        • Gene Fragments
        • GeneStrands
        • Express GeneStrands
        • Molecular Biology Services
        • Plasmid Preparation
        • Site Directed Mutagenesis
        • DNA Cloning
        • Optimisation tool
        • GENEius
    • Sanger Sequencing
      • Products & Services
      • Sanger Sequencing
        • Sequencing Services
        • Mix2Seq Services
        • LightRun Services
        • TubeSeq Supreme
        • PlateSeq Supreme
        • Direct Colony Sequencing
        • Prepaid Products
        • Mix2Seq Kits
        • LightRun Barcodes
        • Barcode Labels & Coupons
        • PlateSeq Kits
        • Special Sequencing Services
        • Primer Walking Service
        • Shipping Options
        • Sequencing Accessories
        • Sample Shipment
        • Additional Services
        • Sequencing Primers
        • Free Barcode Labels
        • �
          Mix2Seq Kit
          Fastest Sanger sequencing of premixed samples in tubes.

          Order Now

           

           

    • Nanopore Sequencing
      • Products & Services
      • Nanopore Sequencing
        • ONT Lite Portfolio
        • Whole Plasmid Sequencing
        • Linear / Clonal Amplicons
        • Bacterial Genome Sequencing
        • Bacteria Assembly Hybrid
        • Yeast Genome Sequencing
        • Prepaid ONT Coupons
        • Free barcodes
        • Genome Sequencing
        • Human Whole Genome Sequencing
        • Bacteria Whole Genome Sequencing
        • Whole Genome Sequencing Non-Human
        • Amplicon Sequencing
        • Custom Long-Read Amplicon Sequencing
        • 16S Full-Length Microbiome
        • Prepaid ONT Lite Coupons
          A Unique Prepayment Option for your sequencing with Oxford Nanopore

          Learn more

           

           

    • Next Generation Sequencing
      • Products & Services
      • Next Generation Sequencing
        • Genome Sequencing
        • Human WGS
        • Non-human WGS
        • INVIEW Resequencing
        • Microbiome & Metagenome
        • INVIEW Microbiome
        • INVIEW Metagenome
        • Amplicon Sequencing
        • Amplicon sequencing
        • Amplicon sequencing - incl. amplification
        • Transcriptome
        • INVIEW Transcriptome
        • INVIEW Transcriptome Bacteria
        • NGSelect RNA
        • Exome & Enrichment
        • INVIEW Exome
        • Clinical Research Exome
        • INVIEW Oncoprofiling
        • INVIEW Liquid Biopsy Oncoprofiling
        • Bioinformatic Services
        • RNA-Seq Analysis
        • Variant Analysis Service
        • Metagenome Analysis Service
        • Microbiome Profiling Analysis
        • Prepaid Coupons and free Barcodes
        • Free Barcodes
        • NGS Prepaid Coupons
        • Important information
        • Sample Submission Guidelines
        • NGS Publications
        • Special applications
        • INVIEW CRISPR Check
        • INVIEW Virus
        • Prepaid NGS Coupons

           

          A Unique Prepayment Option for our NGS Services

          Learn more

           

           

    • Genotyping & Genexpression
      • Products & Services
      • Genotyping & Genexpression
        • Applied Genomic Services
        • DNA Barcoding
        • Cell Line Authentication
        • Mycoplasmacheck
        • Fragment Length Analysis
        • Genotyping Services
        • SNP Genotyping
        • Copy Number Variation
        • Mikrosatellites/ STR/FLA/ IDAA
        • Gene Expression Services
        • Transcriptome analysis
        • Expression Arrays
        • Target Gene Expression
  • Markets
    • Pharma / Biotech
      • Markets
      • Pharma / Biotech
        • Synthesis Products
        • Industrial-grade NGS Oligos
        • Ultimate Precision Probes
        • Special Oligo Requests
        • Large Scale Oligos
        • Gene Synthesis
        • Gene Fragments
        • Sequencing Services
        • Exome Sequencing
        • Transcriptome Sequencing
        • Genome Sequencing
        • Bioinformatic Solutions for NGS
        • Favorite Content
        • NGS - Disease Diagnostics
        • Cancer Ecology
        • Personalised Cancer Therapy
        • Revolutionising human-like-protein production
        • The Microbiome Of Cancer
        • All about biomarker discovery
    • Agrigenomics
      • Markets
      • Agrigenomics
        • Plant Breeder
        • DNA marker discovery
        • Marker-assisted selection
        • GRAS-Di®
        • Microbiome and metagenomics
        • Animal Breeder
        • DNA Marker discovery
        • Pathogen screening
        • Parentage testing
        • Genomic selection
        • Marker-assisted selection
        • Webshop - GenFarmEval
        • Favorite Content
        • Microarrays Accelerate Blue Biotechnology
        • How To Do NGS 50% Faster
        • NGS Portfolio
        • GenFarmEval.com

          Visit our Webshop for Farmers

          learn more

    • Consumer Genomics
      • Markets
      • Consumer Genomics
        • Sequencing Services
        • Genotyping
        • Epigenome Profiling
        • Microbiome Analysis
        • Shotgun Sequencing
        • Whole Genome Sequencing
        • Additional Services
        • Sample Collection Kits
        • Shipping
        • DNA Extraction
        • Laboratory Service
        • Biobanking
        • Favorite Content
        • Population Genetics
        • The End of Gene Doping
        • Home Genomics Testing
        • IVDR Compliance
    • Food & Environment
      • Markets
      • Food & Environment
        • Food Testing
        • Food Authenticity
        • Meat Traceability
        • Pathogen Traceability
        • Cannabis and Hemp Testing
        • Environmental Testing
        • Non-targeted detection of organisms / species
        • Targeted detection of organisms / species
        • eDNA Tracker
        • Favorite Content
        • Determine the Source of Meat
        • Pine Nuts – Why Testing For Edibility Matters
    • Diagnostic Kit Producer
      • Markets
      • Diagnostic Kit Producer
        • Synthesis Products
        • Large Scale Oligos
        • Special Requests in Tubes
        • Quality Assurance
        • GLP
        • ISO 17025
        • ISO 13485
        • Favorite Content
        • Oligonucleotides For Diagnostics
        • The Future of RNA Applications
    • Research / Biotech
      • Markets
      • Research / Biotech
        • Favorite Services
        • Custom DNA Oligos
        • TubeSeq Service Sanger
        • INVIEW Microbiome NGS
        • NGS Services
        • GeneStrands
        • Express Services
        • Mix2Seq NightXpress
        • Express Genes
        • Express GeneStrands
        • Favorite Content
        • Eurofins Genomics Goes Green
        • GENEius – Codon Usage Optimisation
        • 5 tips to speed up your qPCR
        • Why salt-free oligos are the unsung hero of molecular biology
  • Resources
    • Account
      • Resources
      • Account
        • My profile
        • Orders
        • Quotes
        • Groups
        • Preferences
        • Addresses
        • Dropboxes Nearby
        • Barcode Management
        • Sanger Barcode Management
        • NGS Barcode Management
        • Genotyping Barcode Management
        • Oligo Barcode Management
        • Primer / Cell Line Management
        • Sanger Sequencing Primers
        • Cell Line Management
    • Solutions
      • Resources
      • Solutions
        • EVOCARD Options
        • EVOcard Payment Method
        • Order or Refill EVOcards
        •  

    • Other Resources
      • Resources
      • Other Resources
        • Frequently Asked Questions (FAQs)
        • Video Tutorials
        • GENEius
        • Excel Upload Forms Oligos
    • Tools
      • Resources
      • Tools
        • Design tools
        • PCR Primer Design Tool
        • Sequencing Primer Design Tool
        • Oligo Analysis Tool
  • About us
    • About Us
      • About us
      • About Us
        • About Eurofins
        • Careers
        • Distributors
        • News
        • Holiday Hours
    • Quality Control
      • About us
      • Quality Control
        • Quality Assurance
    • Promotions
      • About us
      • Promotions
        • View all promotions
  • Contact
Login | Create Account
 

NGSgrade Oligos for MiSeq

  Intro & Info

The Amplicon 2nd PCR Oligos have been developed especially to allow pooling of samples for NGS on Illumina

They are designed and validated by our in-house NextGen sequencing lab.

How it works
  • You provide amplicons generated with NGS primers consisting of the target specific sequences and a universal adapter sequence
  • During library prep, Eurofins Genomics adds indexed sequencing adaptors necessary for sample discrimination

How to order
  • Please download our Excel template first, which is specifically coded for designing your 2nd PCR primers
  • Each PCR product must harbor universal adaptors on both ends of the fragment
  • We are directly adding the required adaptor sequences to the target specific primer sequences you are uploading
  • For a correct design, you must provide those sequences in 5’ -3’ direction
  • You may provide in the upload form different forward and reverse primers in case you are targeting more than one region
  • Upload the filled Excel form and press "Next". Options for synthesis scales and delivery format are found in the next step
  • Check your uploaded sequences on the next step and press "Add to Cart"

Adaptor sequences
  • Forward Primer Sequence: ACACTCTTTCCCTACACGACGCTCTTCCGATCT
  • Reverse Primer Sequence: GACTGGAGTTCAGACGTGTGCTCTTCCGATCT

 
  • Select your entry format
  • Specify your oligos
 

Entry Format

XLS Icon Download our Excel template for uploading your NGS Oligos.
Please read more details in above INTRO & INFO box by clicking on the arrow icon.
 
 
 
Define your oligos by using our Excel template above. Upload your file and press "Next".
 
 
Next
 
Contact Us

TECHNICAL SUPPORT

Phone: +49 7531 816068

E-Mail: support-eu@genomics.eurofinseu.com

HOURS

Mon-Thu: 8 : 00 AM – 6 : 00 PM, ET

Fri: 8 : 00 AM – 6 : 00 PM, ET

TOLL FREE PHONE NUMBER

Direct Line: 00800-200 100 20

E-Mail: support-eu@genomics.eurofinseu.com

HOURS

Mon-Fri: 8 : 00 AM – 3 : 00 PM, ET

QUOTES, PRICING & SPECIAL REQUESTS

Quotes are submitted, reviewed, and accepted through the online quoting tool. Learn more.
Please direct inquires about pricing and special project requests to your sales representative.
General questions: support-eu@genomics.eurofinseu.com

Change Region

  • Europe (current website)
  • Americas
  • India
  • Japan

We love hearing from our customers. Feel free to leave feedback.

Submit Feedback
Careers
  • ISO 9001
  • ISO 13485
  • ISO 17025

2025 - Copyright Eurofins Genomics

  • Terms & Conditions
  • Corporate
  • Privacy
Frequently asked questions
Contact us
Subscribe to newsletter
VEGA Beta