INVIEW Microbiome Profiling

INVIEW Microbiome profiling using short reads

Our INVIEW Microbiome Profiling provides highly sensitive identification and classification of bacteria, funghi and archaea including 16S, 18S, ITS studies, as well as population analyses across various environmental, food, and clinical samples.

Eurofins Genomics amplifies and sequences <570 bp of the hypervariable regions of the 16S and 18S rRNA genes and the fungal internal transcribed spacer (ITS) gene. If your target isn’t covered by established primer sets, we offer a custom target implementation service to meet your needs.

Choose our standard option, which provides approximately 20,000 reads per sample (no guarantee), or upgrade to our premium packages with guaranteed 60,000 reads for enhanced data quality at competitive prices.

For 16S full-length sequencing, please utilize our new long-read V1V9 16S sequencing service here.

If you prepare your own 16S, 18S or ITS amplicons, we recommend utilizing our short- and long-read amplicon sequencing services.

>> Get Quote / Order

>> Order Barcodes

>> Redeem NGS Coupons

Highlights

No sample number limitation
Ultra-low price for more than 192 samples per batch
Generation of 1 to 4 amplicons per DNA sample (choose from our target list)
Illumina sequencing with 2 x 300 bp paired-end read module
Services are performed in ISO17025 certified labs
Comprehensive bioinformatics service & interactive analysis reports
Data transfer via secure FTP

Application & services

We provide optional bioinformatics for trimming and merging of overlapping paired reads or comprehensive 16S microbiome profiling with taxon identification.
For optional DNA isolation service, please refer to our DNA isolation guide.

We do not accept samples with higher biosafety level than S2. GMOs are only accepted with S1 level.

>> FAQ's Microbiome

>> NGS Prepaid Coupons

>> Sample Submission

>> ONT 16S Full Length SEQ

Product Specifications & Ordering

Specifications	Premium - 60k read pairs	Standard - 20k read pairs	High-throughput - 20k read pairs
Number of samples	From 1 sample	From 12 samples	From 184 samples
Run mode	2 x 300 bp	2 x 300 bp	2 x 300 bp
Read amount	60k read pairs	20k read pairs (add-on reads possible)	20k read pairs
Guaranteed reads	Yes	No	No
Target selection	Standard & non-standard targets	Standard & non-standard targets	Standard & non-standard targets
Trimming & merging of overlapping reads	Optional	Optional	Included
Microbial community profiling	Optional	Optional	Optional

Specifications

Generation of 1 – 4 amplicons per DNA sample (you can choose from our target list)
Quality control assessment after target specific amplification
Pooling & normalisation of amplicons
Sequencing on Illumina´s MiSeq with the 2 x 300 bp paired-end read module
Delivery of on average 20,000 read pairs or guaranteed 60,000 read pairs per amplicon (+/- 3%)
For the products with 20,000 read pairs, you can order additional multiples of 10,000 read pairs if required.

Starting material

Sample Type: Purified DNA
Purity (OD260/280): 1.8-2.0
Volume: 1 target: 20µL for each additional target plus 10 µL (e.g. 50 µL for 4 targets)
Concentration: 10-50 ng/µL
Minimum Amount: 200 ng
Resuspension Buffer Water, EB, or low TE (<0.1 mM EDTA)
Format: barcode labelled tubes or plates
Shipment Method: Room temperature/ice

Tube format: 1.5 ml safe-lock tubes

Plate format: Eppendorf twin.tec PCR Plate 96, semi-skirted, leave position G12 & H12 empty

Standard targets

If your target isn’t covered by our established standard and non-standard primer sets, we offer a custom target implementation service to meet your needs.

Organism	Gene	Region	Primer Name	Amplicon Length (bp)	Primer Sequence	Orientation	Reference
Bacteria	16S	V1-V3	27F	500	AGAGTTTGATCATGGCTCAG	F	Weisburg et al., 1991
Bacteria	16S	V1-V3	530R	500	GTATTACCGCGGCTGCTG	R	Leser T.D. et al., 2002
Bacteria	16S	V3-V4	347F	430	TACGGGAGGCAGCAG	F	Turner et al., 1999
Bacteria	16S	V3-V4	800R	430	CCAGGGTATCTAATCC	R	Kisand et al., 2002
Bacteria	16S	V3-V5	341F	570	CCTACGGGNGGCWGCAG	F	Herlemann et al., 2011
Bacteria	16S	V3-V5	926R	570	CCGYCAATTYMTTTRAGTTT	R	Quince et al., 2011, EMP
Archaea	16S	V3-V4	340F	450	CCCTAYGGGGYGCASCAG	F	Gantner et al. 2011
Archaea	16S	V3-V4	806R	450	GGACTACNVGGGTWTCTAAT	R	Apprill et al., 2015
Fungi	ITS1		ITS5F	100-1000*	GGAAGTAAAAGTCGTAACAAGG	F	White et al., 1990
Fungi	ITS1		ITS2R	100-1000*	GCTGCGTTCTTCATCGATGC	R	White et al., 1990
Fungi	ITS2		ITSbF	100-800*	GCATCGATGAAGAACGCAGC	F	White et al., 1990
Fungi	ITS2		ITSbR	100-800*	TCCTCCGCTTATTGATATGC	R	White et al., 1990

* The length of the ITS region in fungi can vary significantly depending on the specific species.

Additional non-standard targets available

Organism	Gene	Region	Primer Name	Amplicon Length (bp)	Primer Sequence	Orientation	Reference
Bacteria	16S	V4	515F	270	GTGYCAGCMGCCGCGGTAA	F	Parada et al., 2016
Bacteria	16S	V4	806R	270	GGACTACNVGGGTWTCTAAT	R	Apprill et al., 2015
Bacteria	16S	V1-V3	27F	500	AGRGTTYGATYMTGGCTCAG	F	Walker et al., 2015
Bacteria	16S	V1-V3	534R	500	ATTACCGCGGCTGCTGG	R	Muyzer et al., 1993
Bacteria	16S	V3-V4	341F	450	CCTACGGGNGGCWGCAG	F	Herlemann et al., 2011
Bacteria	16S	V3-V4	806R	450	GGACTACNVGGGTWTCTAAT	R	Apprill et al., 2015
Bacteria	16S	V3-V4	341F	450	CCTACGGGNGGCWGCAG	F	Herlemann et al., 2011
Bacteria	16S	V3-V4	805R	450	GACTACHVGGGTATCTAATCC	R	Nalashenkov et al., 2021
Fungi	18S		FungiF1_F	340*	GTGGTAATTCTAGAGCTAATACATGCT	F	in-house developed
Fungi	18S		FungiF1_R	340*	CCTGTATCAGTATTTATTGTCACTAC	R	in-house developed
Fungi	ITS1		ITS1F	100-1000*	TCCGTAGGTGAACCTGCGG	F	White et al., 1990
Fungi	ITS1		ITS2R	100-1000*	GCTGCGTTCTTCATCGATGC	R	White et al., 1990
Fungi	ITS2		fITS7F	100-800*	GTGARTCATCGAATCTTTG	F	Ihrmark et al, 2012
Fungi	ITS2		ITSbR	100-800*	TCCTCCGCTTATTGATATGC	R	White et al. 1990

* The length of the ITS region in fungi can vary significantly depending on the specific species.

Deliverables

Raw data FASTQ files
Optional trimmed and merged FASTQ files
Optional analysis for comprehensive microbiome profiling:
- Comprehensive profiling report (.PDF)
- Taxonomy tables (.TXT)
- OTU tables, including normalized abundance estimation (.TXT, .BIOM)
- Read sequences of OTU representatives (.FASTA)
- Processed reads sequences that went into the OTU picking process (.FASTA) Taxonomy plots
- View our Microbiome Analysis report below